The Comai laboratory does not work any longer on the REVOLUTA gene. Following our publication in Development we are sometime asked for alleles. The rev-1 allele is available from TAIR. The other alleles described in the paper are no longer available in my laboratory. We distributed seed while available, but the lines seem to have gone to the great fields in the sky. While still in Seattle (around 2005) we searched the TILLING collection of STP for additional alleles. We identified 28 new alleles whose molecular characteristics and TAIR address (CS number) is provided below as a service to the community. A preliminary growth experiment identified at least two alleles that showed strong phenotypes. You should repeat the analysis of phenotype to confirm this.
Credits: The Seattle TILLING Project, by Luca Comai and Steve Henikoff, Funding: NSF
Phenotype
Severe
Refer to table of mutants below
- L487F,STP14383, CS93756 (no image available)
Mild
- A532V, STP5204, CS87661 (no image available)
Primers used for TILLING
start: ggtgcttcatgttttaggcgttgcggtatatc
end: ggctccaaattgtccccaggatctcctgaagctg
Table of TILLING alleles of REVOLUTA
All alleles are in Col er background
| mutation | change on DNA | effect | SIFT score | zygosity | STP number | TAIR collection number |
| i120B6 | g223a | A403= | n | Homo | 4551 | CS87032 |
| i120H7 | g204r | Intron | n | Hetero | 4725 | CS87200 |
| i124B4 | c781y | A532V | 0.63 (3.25) | Hetero | 5204 | CS87661 |
| i124G5 | g704r | Intron | n | Hetero | 5219 | CS87676 |
| i129F3 | g587r | G496R | 0.07 (3.39) | Hetero | 5560 | CS87999 |
| i132F2 | c558y | T486I | 0.04 (3.32) | Hetero | 5683 | CS88122 |
| i137E3 | g245r | G411R | 0.01 (3.25) | Hetero | 6145 | CS88474 |
| i137E5 | c493y | I464= | n | Hetero | 6161 | CS88490 |
| i137G6 | g348r | G445D | 0.03 (3.25) | Hetero | 6172 | CS88501 |
| i152H7 | c833t | Intron | n | Homo | 7132 | CS89560 |
| i157E8 | c584t | P495S | 0.15 (3.34) | Homo | 7517 | CS89917 |
| i160E7 | c560y | L487F | n | Hetero | 7764 | CS90160 |
| i160E7 | g50r | E373= | n | Hetero | 7764 | CS90160 |
| i161C8 | g1013r | G581E | 0.00 (3.25) | Hetero | 7870 | CS90262 |
| i161F5 | g880r | Intron | n | Hetero | 7820 | CS90215 |
| i169A1 | g270r | G419E | 0.00 (3.25) | Hetero | 9395 | CS91666 |
| i174B1 | c500y | L467F | 0.00 (3.25) | Hetero | 7389 | CS89794 |
| i174E8 | g760r | R525K | 0.76 (3.25) | Hetero | 9769 | CS92032 |
| i175D8 | c438y | Intron | n | Hetero | 12060 | CS92971 |
| i179A7 | g930a | E553= | n | Homo | 12324 | CS93229 |
| i189H1 | c560y | L487F | 0.09 (3.32) | Hetero | 14383 | CS93756 |
| i191A2 | g246r | G411E | 0.02 (3.25) | Hetero | 15115 | CS93933 |
| i191A3 | c432y | INTRON | n | Hetero | 15126 | CS93944 |
| i191F3 | c464y | INTRON | n | Hetero | 15135 | CS93952 |
| i192F8 | g566r | A489T | 0.63 (3.32) | Hetero | 15268 | CS94073 |
| i193C3 | g854a | Intron | n | Homo | 15292 | CS94094 |
| i198C3 | g524r | A475T | 0.00 (3.32) | Hetero | 10363 | CS92430 |
| i92D7 | g520r | E473= | n | Hetero | 2331 | CS85496 |
Comai Lab 