REVOLUTA Legacy

The Comai laboratory does not work any longer on the REVOLUTA gene. Following our publication in Development we are sometime asked for alleles. The rev-1 allele is available from TAIR. The other alleles described in the paper are no longer available in my laboratory. We distributed seed while available, but the lines seem to have gone to the great fields in the sky. While still in Seattle (around 2005) we searched the TILLING collection of STP for additional alleles. We identified 28 new alleles whose molecular characteristics and TAIR address (CS number) is provided below as a service to the community. A preliminary growth experiment identified at least two alleles that showed strong phenotypes. You should repeat the analysis of phenotype to confirm this. 

Credits: The Seattle TILLING Project, by Luca Comai and Steve Henikoff, Funding: NSF


Phenotype

Severe

Refer to table of mutants below

G581E, STP7870, CS90262
  • L487F,STP14383, CS93756 (no image available)

Mild

A475T, STP#10363, CS92430
  • A532V, STP5204, CS87661 (no image available)

Primers used for TILLING

start: ggtgcttcatgttttaggcgttgcggtatatc

end: ggctccaaattgtccccaggatctcctgaagctg


Table of TILLING alleles of REVOLUTA

All alleles are in Col er background

mutationchange on DNAeffectSIFT scorezygositySTP numberTAIR collection number
i120B6g223aA403=nHomo4551CS87032
i120H7g204rIntronnHetero4725CS87200
i124B4c781yA532V0.63 (3.25)Hetero5204CS87661
i124G5g704rIntronnHetero5219CS87676
i129F3g587rG496R0.07 (3.39)Hetero5560CS87999
i132F2c558yT486I0.04 (3.32)Hetero5683CS88122
i137E3g245rG411R0.01 (3.25)Hetero6145CS88474
i137E5c493yI464=nHetero6161CS88490
i137G6g348rG445D0.03 (3.25)Hetero6172CS88501
i152H7c833tIntronnHomo7132CS89560
i157E8c584tP495S0.15 (3.34)Homo7517CS89917
i160E7c560yL487FnHetero7764CS90160
i160E7g50rE373=nHetero7764CS90160
i161C8g1013rG581E0.00 (3.25)Hetero7870CS90262
i161F5g880rIntronnHetero7820CS90215
i169A1g270rG419E0.00 (3.25)Hetero9395CS91666
i174B1c500yL467F0.00 (3.25)Hetero7389CS89794
i174E8g760rR525K0.76 (3.25)Hetero9769CS92032
i175D8c438yIntronnHetero12060CS92971
i179A7g930aE553=nHomo12324CS93229
i189H1c560yL487F0.09 (3.32)Hetero14383CS93756
i191A2g246rG411E0.02 (3.25)Hetero15115CS93933
i191A3c432yINTRONnHetero15126CS93944
i191F3c464yINTRONnHetero15135CS93952
i192F8g566rA489T0.63 (3.32)Hetero15268CS94073
i193C3g854aIntronnHomo15292CS94094
i198C3g524rA475T0.00 (3.32)Hetero10363CS92430
i92D7g520rE473=nHetero2331CS85496
<span>%d</span> bloggers like this: